ID: 1139251486

View in Genome Browser
Species Human (GRCh38)
Location 16:65500662-65500684
Sequence GGGCCTCCTAACATCCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139251486_1139251490 20 Left 1139251486 16:65500662-65500684 CCATTGTGGATGTTAGGAGGCCC No data
Right 1139251490 16:65500705-65500727 TTGTTTGTTTGTTTTTCCTGAGG 0: 4
1: 25
2: 157
3: 1044
4: 6135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139251486 Original CRISPR GGGCCTCCTAACATCCACAA TGG (reversed) Intergenic
No off target data available for this crispr