ID: 1139251611

View in Genome Browser
Species Human (GRCh38)
Location 16:65501900-65501922
Sequence GTGTCATGGTTGAAGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139251611_1139251616 25 Left 1139251611 16:65501900-65501922 CCAACCACCTTCAACCATGACAC No data
Right 1139251616 16:65501948-65501970 ACTTCCTCCCGTACCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139251611 Original CRISPR GTGTCATGGTTGAAGGTGGT TGG (reversed) Intergenic
No off target data available for this crispr