ID: 1139253503

View in Genome Browser
Species Human (GRCh38)
Location 16:65519286-65519308
Sequence GCTACATGGCAGGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139253498_1139253503 0 Left 1139253498 16:65519263-65519285 CCTGTTGTATTTTGGGAACTGTT No data
Right 1139253503 16:65519286-65519308 GCTACATGGCAGGAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139253503 Original CRISPR GCTACATGGCAGGAGGAGGA TGG Intergenic
No off target data available for this crispr