ID: 1139259467

View in Genome Browser
Species Human (GRCh38)
Location 16:65577882-65577904
Sequence CAAGTCGGCCACTGTGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139259467_1139259470 -2 Left 1139259467 16:65577882-65577904 CCTAGATCACAGTGGCCGACTTG No data
Right 1139259470 16:65577903-65577925 TGATTCAAAGCATCAGAAGGTGG No data
1139259467_1139259471 5 Left 1139259467 16:65577882-65577904 CCTAGATCACAGTGGCCGACTTG No data
Right 1139259471 16:65577910-65577932 AAGCATCAGAAGGTGGACAGAGG No data
1139259467_1139259469 -5 Left 1139259467 16:65577882-65577904 CCTAGATCACAGTGGCCGACTTG No data
Right 1139259469 16:65577900-65577922 ACTTGATTCAAAGCATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139259467 Original CRISPR CAAGTCGGCCACTGTGATCT AGG (reversed) Intergenic
No off target data available for this crispr