ID: 1139259888

View in Genome Browser
Species Human (GRCh38)
Location 16:65581219-65581241
Sequence CTGTAGATACACATTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139259883_1139259888 24 Left 1139259883 16:65581172-65581194 CCTCAAAAAACAACAAAAAGAAA No data
Right 1139259888 16:65581219-65581241 CTGTAGATACACATTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139259888 Original CRISPR CTGTAGATACACATTGAGGT TGG Intergenic
No off target data available for this crispr