ID: 1139263773

View in Genome Browser
Species Human (GRCh38)
Location 16:65621103-65621125
Sequence CTGCATGTATGTGATTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139263773_1139263775 30 Left 1139263773 16:65621103-65621125 CCTTTAAAATCACATACATGCAG No data
Right 1139263775 16:65621156-65621178 TCAGAGCAAGTCCTCACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139263773 Original CRISPR CTGCATGTATGTGATTTTAA AGG (reversed) Intergenic
No off target data available for this crispr