ID: 1139264563

View in Genome Browser
Species Human (GRCh38)
Location 16:65626710-65626732
Sequence GCTCCATGGTGCAGTGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139264560_1139264563 2 Left 1139264560 16:65626685-65626707 CCGTTGCTCACAGAAGGAAAGTC No data
Right 1139264563 16:65626710-65626732 GCTCCATGGTGCAGTGCTTAGGG No data
1139264558_1139264563 14 Left 1139264558 16:65626673-65626695 CCTGCTTAGAAACCGTTGCTCAC No data
Right 1139264563 16:65626710-65626732 GCTCCATGGTGCAGTGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139264563 Original CRISPR GCTCCATGGTGCAGTGCTTA GGG Intergenic
No off target data available for this crispr