ID: 1139264865

View in Genome Browser
Species Human (GRCh38)
Location 16:65629200-65629222
Sequence CTGCAAACAAAAAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139264865_1139264869 11 Left 1139264865 16:65629200-65629222 CCTTCCTCATTTTTTGTTTGCAG No data
Right 1139264869 16:65629234-65629256 AAAATTCTTAGCACGCTCCCAGG No data
1139264865_1139264870 19 Left 1139264865 16:65629200-65629222 CCTTCCTCATTTTTTGTTTGCAG No data
Right 1139264870 16:65629242-65629264 TAGCACGCTCCCAGGCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139264865 Original CRISPR CTGCAAACAAAAAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr