ID: 1139264869

View in Genome Browser
Species Human (GRCh38)
Location 16:65629234-65629256
Sequence AAAATTCTTAGCACGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139264866_1139264869 7 Left 1139264866 16:65629204-65629226 CCTCATTTTTTGTTTGCAGCTCC No data
Right 1139264869 16:65629234-65629256 AAAATTCTTAGCACGCTCCCAGG No data
1139264864_1139264869 12 Left 1139264864 16:65629199-65629221 CCCTTCCTCATTTTTTGTTTGCA No data
Right 1139264869 16:65629234-65629256 AAAATTCTTAGCACGCTCCCAGG No data
1139264865_1139264869 11 Left 1139264865 16:65629200-65629222 CCTTCCTCATTTTTTGTTTGCAG No data
Right 1139264869 16:65629234-65629256 AAAATTCTTAGCACGCTCCCAGG No data
1139264862_1139264869 29 Left 1139264862 16:65629182-65629204 CCCTTCACTCAAAAACTCCCTTC No data
Right 1139264869 16:65629234-65629256 AAAATTCTTAGCACGCTCCCAGG No data
1139264863_1139264869 28 Left 1139264863 16:65629183-65629205 CCTTCACTCAAAAACTCCCTTCC No data
Right 1139264869 16:65629234-65629256 AAAATTCTTAGCACGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139264869 Original CRISPR AAAATTCTTAGCACGCTCCC AGG Intergenic
No off target data available for this crispr