ID: 1139264870

View in Genome Browser
Species Human (GRCh38)
Location 16:65629242-65629264
Sequence TAGCACGCTCCCAGGCCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139264865_1139264870 19 Left 1139264865 16:65629200-65629222 CCTTCCTCATTTTTTGTTTGCAG No data
Right 1139264870 16:65629242-65629264 TAGCACGCTCCCAGGCCCCTAGG No data
1139264867_1139264870 -6 Left 1139264867 16:65629225-65629247 CCCAATGTCAAAATTCTTAGCAC No data
Right 1139264870 16:65629242-65629264 TAGCACGCTCCCAGGCCCCTAGG No data
1139264864_1139264870 20 Left 1139264864 16:65629199-65629221 CCCTTCCTCATTTTTTGTTTGCA No data
Right 1139264870 16:65629242-65629264 TAGCACGCTCCCAGGCCCCTAGG No data
1139264868_1139264870 -7 Left 1139264868 16:65629226-65629248 CCAATGTCAAAATTCTTAGCACG No data
Right 1139264870 16:65629242-65629264 TAGCACGCTCCCAGGCCCCTAGG No data
1139264866_1139264870 15 Left 1139264866 16:65629204-65629226 CCTCATTTTTTGTTTGCAGCTCC No data
Right 1139264870 16:65629242-65629264 TAGCACGCTCCCAGGCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139264870 Original CRISPR TAGCACGCTCCCAGGCCCCT AGG Intergenic
No off target data available for this crispr