ID: 1139265146

View in Genome Browser
Species Human (GRCh38)
Location 16:65631449-65631471
Sequence TTGTTACAATGCAAGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139265146_1139265152 19 Left 1139265146 16:65631449-65631471 CCATTGATCTTGCATTGTAACAA No data
Right 1139265152 16:65631491-65631513 GTAGCTTAGCGGTGCTTCCCAGG No data
1139265146_1139265153 20 Left 1139265146 16:65631449-65631471 CCATTGATCTTGCATTGTAACAA No data
Right 1139265153 16:65631492-65631514 TAGCTTAGCGGTGCTTCCCAGGG No data
1139265146_1139265149 8 Left 1139265146 16:65631449-65631471 CCATTGATCTTGCATTGTAACAA No data
Right 1139265149 16:65631480-65631502 CCCCTCAGACTGTAGCTTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139265146 Original CRISPR TTGTTACAATGCAAGATCAA TGG (reversed) Intergenic
No off target data available for this crispr