ID: 1139269689

View in Genome Browser
Species Human (GRCh38)
Location 16:65670674-65670696
Sequence AGTTTAGATGTGAGGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139269689_1139269698 -6 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269698 16:65670691-65670713 TAAACTGGGGGGGTCCCAACTGG No data
1139269689_1139269704 16 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269704 16:65670713-65670735 GACACACAGAATGTTTGTGGGGG No data
1139269689_1139269701 13 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269701 16:65670710-65670732 CTGGACACACAGAATGTTTGTGG No data
1139269689_1139269705 25 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269705 16:65670722-65670744 AATGTTTGTGGGGGTCAAAGAGG No data
1139269689_1139269703 15 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269703 16:65670712-65670734 GGACACACAGAATGTTTGTGGGG No data
1139269689_1139269707 30 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269707 16:65670727-65670749 TTGTGGGGGTCAAAGAGGTAGGG No data
1139269689_1139269706 29 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269706 16:65670726-65670748 TTTGTGGGGGTCAAAGAGGTAGG No data
1139269689_1139269702 14 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269702 16:65670711-65670733 TGGACACACAGAATGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139269689 Original CRISPR AGTTTAGATGTGAGGAAACA GGG (reversed) Intergenic