ID: 1139269697

View in Genome Browser
Species Human (GRCh38)
Location 16:65670682-65670704
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139269697_1139269703 7 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269703 16:65670712-65670734 GGACACACAGAATGTTTGTGGGG No data
1139269697_1139269705 17 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269705 16:65670722-65670744 AATGTTTGTGGGGGTCAAAGAGG No data
1139269697_1139269702 6 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269702 16:65670711-65670733 TGGACACACAGAATGTTTGTGGG No data
1139269697_1139269708 23 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269708 16:65670728-65670750 TGTGGGGGTCAAAGAGGTAGGGG No data
1139269697_1139269709 26 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269709 16:65670731-65670753 GGGGGTCAAAGAGGTAGGGGTGG No data
1139269697_1139269706 21 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269706 16:65670726-65670748 TTTGTGGGGGTCAAAGAGGTAGG No data
1139269697_1139269707 22 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269707 16:65670727-65670749 TTGTGGGGGTCAAAGAGGTAGGG No data
1139269697_1139269704 8 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269704 16:65670713-65670735 GACACACAGAATGTTTGTGGGGG No data
1139269697_1139269701 5 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269701 16:65670710-65670732 CTGGACACACAGAATGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139269697 Original CRISPR ACCCCCCCAGTTTAGATGTG AGG (reversed) Intergenic