ID: 1139269699

View in Genome Browser
Species Human (GRCh38)
Location 16:65670705-65670727
Sequence AACATTCTGTGTGTCCAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139269699_1139269707 -1 Left 1139269699 16:65670705-65670727 CCCAACTGGACACACAGAATGTT No data
Right 1139269707 16:65670727-65670749 TTGTGGGGGTCAAAGAGGTAGGG No data
1139269699_1139269709 3 Left 1139269699 16:65670705-65670727 CCCAACTGGACACACAGAATGTT No data
Right 1139269709 16:65670731-65670753 GGGGGTCAAAGAGGTAGGGGTGG No data
1139269699_1139269706 -2 Left 1139269699 16:65670705-65670727 CCCAACTGGACACACAGAATGTT No data
Right 1139269706 16:65670726-65670748 TTTGTGGGGGTCAAAGAGGTAGG No data
1139269699_1139269708 0 Left 1139269699 16:65670705-65670727 CCCAACTGGACACACAGAATGTT No data
Right 1139269708 16:65670728-65670750 TGTGGGGGTCAAAGAGGTAGGGG No data
1139269699_1139269705 -6 Left 1139269699 16:65670705-65670727 CCCAACTGGACACACAGAATGTT No data
Right 1139269705 16:65670722-65670744 AATGTTTGTGGGGGTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139269699 Original CRISPR AACATTCTGTGTGTCCAGTT GGG (reversed) Intergenic
No off target data available for this crispr