ID: 1139269702

View in Genome Browser
Species Human (GRCh38)
Location 16:65670711-65670733
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139269689_1139269702 14 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269702 16:65670711-65670733 TGGACACACAGAATGTTTGTGGG No data
1139269697_1139269702 6 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269702 16:65670711-65670733 TGGACACACAGAATGTTTGTGGG No data
1139269688_1139269702 15 Left 1139269688 16:65670673-65670695 CCCCTGTTTCCTCACATCTAAAC No data
Right 1139269702 16:65670711-65670733 TGGACACACAGAATGTTTGTGGG No data
1139269690_1139269702 13 Left 1139269690 16:65670675-65670697 CCTGTTTCCTCACATCTAAACTG No data
Right 1139269702 16:65670711-65670733 TGGACACACAGAATGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139269702 Original CRISPR TGGACACACAGAATGTTTGT GGG Intergenic