ID: 1139269707

View in Genome Browser
Species Human (GRCh38)
Location 16:65670727-65670749
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139269700_1139269707 -2 Left 1139269700 16:65670706-65670728 CCAACTGGACACACAGAATGTTT No data
Right 1139269707 16:65670727-65670749 TTGTGGGGGTCAAAGAGGTAGGG No data
1139269699_1139269707 -1 Left 1139269699 16:65670705-65670727 CCCAACTGGACACACAGAATGTT No data
Right 1139269707 16:65670727-65670749 TTGTGGGGGTCAAAGAGGTAGGG No data
1139269690_1139269707 29 Left 1139269690 16:65670675-65670697 CCTGTTTCCTCACATCTAAACTG No data
Right 1139269707 16:65670727-65670749 TTGTGGGGGTCAAAGAGGTAGGG No data
1139269689_1139269707 30 Left 1139269689 16:65670674-65670696 CCCTGTTTCCTCACATCTAAACT No data
Right 1139269707 16:65670727-65670749 TTGTGGGGGTCAAAGAGGTAGGG No data
1139269697_1139269707 22 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269707 16:65670727-65670749 TTGTGGGGGTCAAAGAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139269707 Original CRISPR TTGTGGGGGTCAAAGAGGTA GGG Intergenic