ID: 1139269709 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:65670731-65670753 |
| Sequence | GGGGGTCAAAGAGGTAGGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139269697_1139269709 | 26 | Left | 1139269697 | 16:65670682-65670704 | CCTCACATCTAAACTGGGGGGGT | No data | ||
| Right | 1139269709 | 16:65670731-65670753 | GGGGGTCAAAGAGGTAGGGGTGG | No data | ||||
| 1139269699_1139269709 | 3 | Left | 1139269699 | 16:65670705-65670727 | CCCAACTGGACACACAGAATGTT | No data | ||
| Right | 1139269709 | 16:65670731-65670753 | GGGGGTCAAAGAGGTAGGGGTGG | No data | ||||
| 1139269700_1139269709 | 2 | Left | 1139269700 | 16:65670706-65670728 | CCAACTGGACACACAGAATGTTT | No data | ||
| Right | 1139269709 | 16:65670731-65670753 | GGGGGTCAAAGAGGTAGGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139269709 | Original CRISPR | GGGGGTCAAAGAGGTAGGGG TGG | Intergenic | ||
| No off target data available for this crispr | |||||