ID: 1139269709 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:65670731-65670753 |
Sequence | GGGGGTCAAAGAGGTAGGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1139269699_1139269709 | 3 | Left | 1139269699 | 16:65670705-65670727 | CCCAACTGGACACACAGAATGTT | No data | ||
Right | 1139269709 | 16:65670731-65670753 | GGGGGTCAAAGAGGTAGGGGTGG | No data | ||||
1139269697_1139269709 | 26 | Left | 1139269697 | 16:65670682-65670704 | CCTCACATCTAAACTGGGGGGGT | No data | ||
Right | 1139269709 | 16:65670731-65670753 | GGGGGTCAAAGAGGTAGGGGTGG | No data | ||||
1139269700_1139269709 | 2 | Left | 1139269700 | 16:65670706-65670728 | CCAACTGGACACACAGAATGTTT | No data | ||
Right | 1139269709 | 16:65670731-65670753 | GGGGGTCAAAGAGGTAGGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1139269709 | Original CRISPR | GGGGGTCAAAGAGGTAGGGG TGG | Intergenic | ||