ID: 1139269709

View in Genome Browser
Species Human (GRCh38)
Location 16:65670731-65670753
Sequence GGGGGTCAAAGAGGTAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139269697_1139269709 26 Left 1139269697 16:65670682-65670704 CCTCACATCTAAACTGGGGGGGT No data
Right 1139269709 16:65670731-65670753 GGGGGTCAAAGAGGTAGGGGTGG No data
1139269699_1139269709 3 Left 1139269699 16:65670705-65670727 CCCAACTGGACACACAGAATGTT No data
Right 1139269709 16:65670731-65670753 GGGGGTCAAAGAGGTAGGGGTGG No data
1139269700_1139269709 2 Left 1139269700 16:65670706-65670728 CCAACTGGACACACAGAATGTTT No data
Right 1139269709 16:65670731-65670753 GGGGGTCAAAGAGGTAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139269709 Original CRISPR GGGGGTCAAAGAGGTAGGGG TGG Intergenic
No off target data available for this crispr