ID: 1139270024

View in Genome Browser
Species Human (GRCh38)
Location 16:65673211-65673233
Sequence GCCATGAGCATTGTGATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139270024_1139270029 13 Left 1139270024 16:65673211-65673233 CCAAGGATCACAATGCTCATGGC No data
Right 1139270029 16:65673247-65673269 ATTAAAAGCAGCAGGGGATTGGG No data
1139270024_1139270027 7 Left 1139270024 16:65673211-65673233 CCAAGGATCACAATGCTCATGGC No data
Right 1139270027 16:65673241-65673263 TATGAAATTAAAAGCAGCAGGGG No data
1139270024_1139270025 5 Left 1139270024 16:65673211-65673233 CCAAGGATCACAATGCTCATGGC No data
Right 1139270025 16:65673239-65673261 ATTATGAAATTAAAAGCAGCAGG No data
1139270024_1139270031 22 Left 1139270024 16:65673211-65673233 CCAAGGATCACAATGCTCATGGC No data
Right 1139270031 16:65673256-65673278 AGCAGGGGATTGGGGATTTTAGG No data
1139270024_1139270032 28 Left 1139270024 16:65673211-65673233 CCAAGGATCACAATGCTCATGGC No data
Right 1139270032 16:65673262-65673284 GGATTGGGGATTTTAGGAAAAGG No data
1139270024_1139270030 14 Left 1139270024 16:65673211-65673233 CCAAGGATCACAATGCTCATGGC No data
Right 1139270030 16:65673248-65673270 TTAAAAGCAGCAGGGGATTGGGG No data
1139270024_1139270028 12 Left 1139270024 16:65673211-65673233 CCAAGGATCACAATGCTCATGGC No data
Right 1139270028 16:65673246-65673268 AATTAAAAGCAGCAGGGGATTGG No data
1139270024_1139270026 6 Left 1139270024 16:65673211-65673233 CCAAGGATCACAATGCTCATGGC No data
Right 1139270026 16:65673240-65673262 TTATGAAATTAAAAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139270024 Original CRISPR GCCATGAGCATTGTGATCCT TGG (reversed) Intergenic
No off target data available for this crispr