ID: 1139271325

View in Genome Browser
Species Human (GRCh38)
Location 16:65686125-65686147
Sequence CTCTCTAAATAGATCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139271325_1139271331 -8 Left 1139271325 16:65686125-65686147 CCATGGTAGATCTATTTAGAGAG No data
Right 1139271331 16:65686140-65686162 TTAGAGAGGAATGGAAGGGGAGG No data
1139271325_1139271332 -5 Left 1139271325 16:65686125-65686147 CCATGGTAGATCTATTTAGAGAG No data
Right 1139271332 16:65686143-65686165 GAGAGGAATGGAAGGGGAGGAGG No data
1139271325_1139271333 -4 Left 1139271325 16:65686125-65686147 CCATGGTAGATCTATTTAGAGAG No data
Right 1139271333 16:65686144-65686166 AGAGGAATGGAAGGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139271325 Original CRISPR CTCTCTAAATAGATCTACCA TGG (reversed) Intergenic
No off target data available for this crispr