ID: 1139273463

View in Genome Browser
Species Human (GRCh38)
Location 16:65705052-65705074
Sequence TGGTGCCCTCTAGGGGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139273463_1139273476 10 Left 1139273463 16:65705052-65705074 CCAGTTACCCCTAGAGGGCACCA No data
Right 1139273476 16:65705085-65705107 AGGCAGGGTCAGATCTGCCAGGG No data
1139273463_1139273472 -6 Left 1139273463 16:65705052-65705074 CCAGTTACCCCTAGAGGGCACCA No data
Right 1139273472 16:65705069-65705091 GCACCAGGGCTCAGGGAGGCAGG No data
1139273463_1139273471 -10 Left 1139273463 16:65705052-65705074 CCAGTTACCCCTAGAGGGCACCA No data
Right 1139273471 16:65705065-65705087 GAGGGCACCAGGGCTCAGGGAGG No data
1139273463_1139273473 -5 Left 1139273463 16:65705052-65705074 CCAGTTACCCCTAGAGGGCACCA No data
Right 1139273473 16:65705070-65705092 CACCAGGGCTCAGGGAGGCAGGG No data
1139273463_1139273475 9 Left 1139273463 16:65705052-65705074 CCAGTTACCCCTAGAGGGCACCA No data
Right 1139273475 16:65705084-65705106 GAGGCAGGGTCAGATCTGCCAGG No data
1139273463_1139273477 22 Left 1139273463 16:65705052-65705074 CCAGTTACCCCTAGAGGGCACCA No data
Right 1139273477 16:65705097-65705119 ATCTGCCAGGGTTCAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139273463 Original CRISPR TGGTGCCCTCTAGGGGTAAC TGG (reversed) Intergenic
No off target data available for this crispr