ID: 1139278798

View in Genome Browser
Species Human (GRCh38)
Location 16:65751916-65751938
Sequence CTATGACTATGGAGGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139278798_1139278808 22 Left 1139278798 16:65751916-65751938 CCCATCTCCCTCCATAGTCATAG No data
Right 1139278808 16:65751961-65751983 AGATCTCAATTTATCTGGCTGGG No data
1139278798_1139278807 21 Left 1139278798 16:65751916-65751938 CCCATCTCCCTCCATAGTCATAG No data
Right 1139278807 16:65751960-65751982 CAGATCTCAATTTATCTGGCTGG No data
1139278798_1139278806 17 Left 1139278798 16:65751916-65751938 CCCATCTCCCTCCATAGTCATAG No data
Right 1139278806 16:65751956-65751978 CCTTCAGATCTCAATTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139278798 Original CRISPR CTATGACTATGGAGGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr