ID: 1139278807

View in Genome Browser
Species Human (GRCh38)
Location 16:65751960-65751982
Sequence CAGATCTCAATTTATCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139278798_1139278807 21 Left 1139278798 16:65751916-65751938 CCCATCTCCCTCCATAGTCATAG No data
Right 1139278807 16:65751960-65751982 CAGATCTCAATTTATCTGGCTGG No data
1139278797_1139278807 22 Left 1139278797 16:65751915-65751937 CCCCATCTCCCTCCATAGTCATA No data
Right 1139278807 16:65751960-65751982 CAGATCTCAATTTATCTGGCTGG No data
1139278802_1139278807 13 Left 1139278802 16:65751924-65751946 CCTCCATAGTCATAGAGCTGGTA No data
Right 1139278807 16:65751960-65751982 CAGATCTCAATTTATCTGGCTGG No data
1139278799_1139278807 20 Left 1139278799 16:65751917-65751939 CCATCTCCCTCCATAGTCATAGA No data
Right 1139278807 16:65751960-65751982 CAGATCTCAATTTATCTGGCTGG No data
1139278803_1139278807 10 Left 1139278803 16:65751927-65751949 CCATAGTCATAGAGCTGGTAGTG No data
Right 1139278807 16:65751960-65751982 CAGATCTCAATTTATCTGGCTGG No data
1139278801_1139278807 14 Left 1139278801 16:65751923-65751945 CCCTCCATAGTCATAGAGCTGGT No data
Right 1139278807 16:65751960-65751982 CAGATCTCAATTTATCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139278807 Original CRISPR CAGATCTCAATTTATCTGGC TGG Intergenic
No off target data available for this crispr