ID: 1139283343

View in Genome Browser
Species Human (GRCh38)
Location 16:65788538-65788560
Sequence GCACATGGACCTGGGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139283343_1139283353 25 Left 1139283343 16:65788538-65788560 CCTCAGCACCCAGGTCCATGTGC No data
Right 1139283353 16:65788586-65788608 CCTGCCCCTGATTGGAGAGCTGG No data
1139283343_1139283354 26 Left 1139283343 16:65788538-65788560 CCTCAGCACCCAGGTCCATGTGC No data
Right 1139283354 16:65788587-65788609 CTGCCCCTGATTGGAGAGCTGGG No data
1139283343_1139283349 17 Left 1139283343 16:65788538-65788560 CCTCAGCACCCAGGTCCATGTGC No data
Right 1139283349 16:65788578-65788600 ACACCCAGCCTGCCCCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139283343 Original CRISPR GCACATGGACCTGGGTGCTG AGG (reversed) Intergenic
No off target data available for this crispr