ID: 1139287059

View in Genome Browser
Species Human (GRCh38)
Location 16:65825194-65825216
Sequence GTGATTAGGCTCCGTATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139287059_1139287063 20 Left 1139287059 16:65825194-65825216 CCTCAGATACGGAGCCTAATCAC No data
Right 1139287063 16:65825237-65825259 TATATCTCAATGATAGCTAAAGG No data
1139287059_1139287061 -4 Left 1139287059 16:65825194-65825216 CCTCAGATACGGAGCCTAATCAC No data
Right 1139287061 16:65825213-65825235 TCACTGAACCAGTTTTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139287059 Original CRISPR GTGATTAGGCTCCGTATCTG AGG (reversed) Intergenic