ID: 1139287302

View in Genome Browser
Species Human (GRCh38)
Location 16:65827081-65827103
Sequence GGTAATCCTGAATTTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139287302_1139287306 -9 Left 1139287302 16:65827081-65827103 CCCCCAACAAATTCAGGATTACC No data
Right 1139287306 16:65827095-65827117 AGGATTACCTCCCTTTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139287302 Original CRISPR GGTAATCCTGAATTTGTTGG GGG (reversed) Intergenic
No off target data available for this crispr