ID: 1139296070

View in Genome Browser
Species Human (GRCh38)
Location 16:65902002-65902024
Sequence AGGGAGAAGCCCCATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139296066_1139296070 3 Left 1139296066 16:65901976-65901998 CCAACTTTGAAATTCTCTCACTA No data
Right 1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG No data
1139296065_1139296070 4 Left 1139296065 16:65901975-65901997 CCCAACTTTGAAATTCTCTCACT No data
Right 1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG No data
1139296064_1139296070 17 Left 1139296064 16:65901962-65901984 CCAGAATAATGAGCCCAACTTTG No data
Right 1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139296070 Original CRISPR AGGGAGAAGCCCCATGAGGC AGG Intergenic
No off target data available for this crispr