ID: 1139297447

View in Genome Browser
Species Human (GRCh38)
Location 16:65915085-65915107
Sequence AACCAGATAAAGATATTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139297447_1139297449 15 Left 1139297447 16:65915085-65915107 CCTGGCAATATCTTTATCTGGTT No data
Right 1139297449 16:65915123-65915145 TGCTGAACTCATAGAATAAGTGG No data
1139297447_1139297450 24 Left 1139297447 16:65915085-65915107 CCTGGCAATATCTTTATCTGGTT No data
Right 1139297450 16:65915132-65915154 CATAGAATAAGTGGAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139297447 Original CRISPR AACCAGATAAAGATATTGCC AGG (reversed) Intergenic
No off target data available for this crispr