ID: 1139299824

View in Genome Browser
Species Human (GRCh38)
Location 16:65935498-65935520
Sequence CCCTATATGAAGAAAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139299824_1139299829 -9 Left 1139299824 16:65935498-65935520 CCACCCATTTTCTTCATATAGGG No data
Right 1139299829 16:65935512-65935534 CATATAGGGAACTGTCATGGTGG No data
1139299824_1139299830 -8 Left 1139299824 16:65935498-65935520 CCACCCATTTTCTTCATATAGGG No data
Right 1139299830 16:65935513-65935535 ATATAGGGAACTGTCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139299824 Original CRISPR CCCTATATGAAGAAAATGGG TGG (reversed) Intergenic
No off target data available for this crispr