ID: 1139300764

View in Genome Browser
Species Human (GRCh38)
Location 16:65943509-65943531
Sequence GGCAGATGGTTGGGTGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139300764_1139300775 12 Left 1139300764 16:65943509-65943531 CCAAGAGCACCCAACCATCTGCC No data
Right 1139300775 16:65943544-65943566 CCACTGGCCCCTCCTCATGCTGG No data
1139300764_1139300768 -4 Left 1139300764 16:65943509-65943531 CCAAGAGCACCCAACCATCTGCC No data
Right 1139300768 16:65943528-65943550 TGCCCCTGTTGCTGCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139300764 Original CRISPR GGCAGATGGTTGGGTGCTCT TGG (reversed) Intergenic
No off target data available for this crispr