ID: 1139303584

View in Genome Browser
Species Human (GRCh38)
Location 16:65964781-65964803
Sequence GGGAAGTCCCTTACAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139303584_1139303587 3 Left 1139303584 16:65964781-65964803 CCAGATTTTGTAAGGGACTTCCC No data
Right 1139303587 16:65964807-65964829 AGCTGCAAGATGAGTTTGTGAGG No data
1139303584_1139303589 7 Left 1139303584 16:65964781-65964803 CCAGATTTTGTAAGGGACTTCCC No data
Right 1139303589 16:65964811-65964833 GCAAGATGAGTTTGTGAGGAGGG No data
1139303584_1139303588 6 Left 1139303584 16:65964781-65964803 CCAGATTTTGTAAGGGACTTCCC No data
Right 1139303588 16:65964810-65964832 TGCAAGATGAGTTTGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139303584 Original CRISPR GGGAAGTCCCTTACAAAATC TGG (reversed) Intergenic
No off target data available for this crispr