ID: 1139306834

View in Genome Browser
Species Human (GRCh38)
Location 16:65993759-65993781
Sequence AGGGAGAGGCAGCATGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139306834_1139306840 17 Left 1139306834 16:65993759-65993781 CCAGGCTCATGCTGCCTCTCCCT No data
Right 1139306840 16:65993799-65993821 GTCTTCTACCCATTCTCTACAGG No data
1139306834_1139306841 18 Left 1139306834 16:65993759-65993781 CCAGGCTCATGCTGCCTCTCCCT No data
Right 1139306841 16:65993800-65993822 TCTTCTACCCATTCTCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139306834 Original CRISPR AGGGAGAGGCAGCATGAGCC TGG (reversed) Intergenic
No off target data available for this crispr