ID: 1139306834 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:65993759-65993781 |
| Sequence | AGGGAGAGGCAGCATGAGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139306834_1139306840 | 17 | Left | 1139306834 | 16:65993759-65993781 | CCAGGCTCATGCTGCCTCTCCCT | No data | ||
| Right | 1139306840 | 16:65993799-65993821 | GTCTTCTACCCATTCTCTACAGG | No data | ||||
| 1139306834_1139306841 | 18 | Left | 1139306834 | 16:65993759-65993781 | CCAGGCTCATGCTGCCTCTCCCT | No data | ||
| Right | 1139306841 | 16:65993800-65993822 | TCTTCTACCCATTCTCTACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139306834 | Original CRISPR | AGGGAGAGGCAGCATGAGCC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||