ID: 1139315887

View in Genome Browser
Species Human (GRCh38)
Location 16:66068318-66068340
Sequence CCTTGCACCCCTAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139315881_1139315887 30 Left 1139315881 16:66068265-66068287 CCAGGTACTGTTCTAAGCATACA No data
Right 1139315887 16:66068318-66068340 CCTTGCACCCCTAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139315887 Original CRISPR CCTTGCACCCCTAAGGTGGA TGG Intergenic
No off target data available for this crispr