ID: 1139315887 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:66068318-66068340 |
| Sequence | CCTTGCACCCCTAAGGTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139315881_1139315887 | 30 | Left | 1139315881 | 16:66068265-66068287 | CCAGGTACTGTTCTAAGCATACA | No data | ||
| Right | 1139315887 | 16:66068318-66068340 | CCTTGCACCCCTAAGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139315887 | Original CRISPR | CCTTGCACCCCTAAGGTGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||