ID: 1139315930

View in Genome Browser
Species Human (GRCh38)
Location 16:66068746-66068768
Sequence ATCTAAAAGCTATACATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139315930_1139315936 19 Left 1139315930 16:66068746-66068768 CCCCAGATGTATAGCTTTTAGAT No data
Right 1139315936 16:66068788-66068810 GGTGCTAGAAAGAAGTCACTGGG No data
1139315930_1139315937 25 Left 1139315930 16:66068746-66068768 CCCCAGATGTATAGCTTTTAGAT No data
Right 1139315937 16:66068794-66068816 AGAAAGAAGTCACTGGGCTCAGG No data
1139315930_1139315934 -2 Left 1139315930 16:66068746-66068768 CCCCAGATGTATAGCTTTTAGAT No data
Right 1139315934 16:66068767-66068789 ATCTAATGATGTTTGGAGTGAGG No data
1139315930_1139315938 26 Left 1139315930 16:66068746-66068768 CCCCAGATGTATAGCTTTTAGAT No data
Right 1139315938 16:66068795-66068817 GAAAGAAGTCACTGGGCTCAGGG No data
1139315930_1139315935 18 Left 1139315930 16:66068746-66068768 CCCCAGATGTATAGCTTTTAGAT No data
Right 1139315935 16:66068787-66068809 AGGTGCTAGAAAGAAGTCACTGG No data
1139315930_1139315933 -9 Left 1139315930 16:66068746-66068768 CCCCAGATGTATAGCTTTTAGAT No data
Right 1139315933 16:66068760-66068782 CTTTTAGATCTAATGATGTTTGG No data
1139315930_1139315939 29 Left 1139315930 16:66068746-66068768 CCCCAGATGTATAGCTTTTAGAT No data
Right 1139315939 16:66068798-66068820 AGAAGTCACTGGGCTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139315930 Original CRISPR ATCTAAAAGCTATACATCTG GGG (reversed) Intergenic
No off target data available for this crispr