ID: 1139315934

View in Genome Browser
Species Human (GRCh38)
Location 16:66068767-66068789
Sequence ATCTAATGATGTTTGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139315932_1139315934 -4 Left 1139315932 16:66068748-66068770 CCAGATGTATAGCTTTTAGATCT No data
Right 1139315934 16:66068767-66068789 ATCTAATGATGTTTGGAGTGAGG No data
1139315930_1139315934 -2 Left 1139315930 16:66068746-66068768 CCCCAGATGTATAGCTTTTAGAT No data
Right 1139315934 16:66068767-66068789 ATCTAATGATGTTTGGAGTGAGG No data
1139315931_1139315934 -3 Left 1139315931 16:66068747-66068769 CCCAGATGTATAGCTTTTAGATC No data
Right 1139315934 16:66068767-66068789 ATCTAATGATGTTTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139315934 Original CRISPR ATCTAATGATGTTTGGAGTG AGG Intergenic
No off target data available for this crispr