ID: 1139326502

View in Genome Browser
Species Human (GRCh38)
Location 16:66156467-66156489
Sequence GGAAATGCACAGCTGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139326500_1139326502 -10 Left 1139326500 16:66156454-66156476 CCGATTCCAAAGAGGAAATGCAC No data
Right 1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG No data
1139326499_1139326502 -6 Left 1139326499 16:66156450-66156472 CCAGCCGATTCCAAAGAGGAAAT No data
Right 1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139326502 Original CRISPR GGAAATGCACAGCTGCAGTC TGG Intergenic
No off target data available for this crispr