ID: 1139328882

View in Genome Browser
Species Human (GRCh38)
Location 16:66172414-66172436
Sequence AAGACTCCCCCAGGAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139328879_1139328882 3 Left 1139328879 16:66172388-66172410 CCTCTCTAGTTCAGGCACCTATG No data
Right 1139328882 16:66172414-66172436 AAGACTCCCCCAGGAGACAGAGG No data
1139328877_1139328882 26 Left 1139328877 16:66172365-66172387 CCAAGTCTTTGAGGTGAGGTCTG No data
Right 1139328882 16:66172414-66172436 AAGACTCCCCCAGGAGACAGAGG No data
1139328875_1139328882 28 Left 1139328875 16:66172363-66172385 CCCCAAGTCTTTGAGGTGAGGTC No data
Right 1139328882 16:66172414-66172436 AAGACTCCCCCAGGAGACAGAGG No data
1139328876_1139328882 27 Left 1139328876 16:66172364-66172386 CCCAAGTCTTTGAGGTGAGGTCT No data
Right 1139328882 16:66172414-66172436 AAGACTCCCCCAGGAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139328882 Original CRISPR AAGACTCCCCCAGGAGACAG AGG Intergenic