ID: 1139330921

View in Genome Browser
Species Human (GRCh38)
Location 16:66189339-66189361
Sequence CAAGCTGGTGGGTTTGATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139330921_1139330927 -9 Left 1139330921 16:66189339-66189361 CCGAGATCAAACCCACCAGCTTG No data
Right 1139330927 16:66189353-66189375 ACCAGCTTGGCTGTCTTCTGGGG No data
1139330921_1139330932 29 Left 1139330921 16:66189339-66189361 CCGAGATCAAACCCACCAGCTTG No data
Right 1139330932 16:66189391-66189413 AAGAGCCTATTCTAGCCTCTTGG No data
1139330921_1139330931 -1 Left 1139330921 16:66189339-66189361 CCGAGATCAAACCCACCAGCTTG No data
Right 1139330931 16:66189361-66189383 GGCTGTCTTCTGGGGGAGGCTGG No data
1139330921_1139330930 -5 Left 1139330921 16:66189339-66189361 CCGAGATCAAACCCACCAGCTTG No data
Right 1139330930 16:66189357-66189379 GCTTGGCTGTCTTCTGGGGGAGG No data
1139330921_1139330929 -8 Left 1139330921 16:66189339-66189361 CCGAGATCAAACCCACCAGCTTG No data
Right 1139330929 16:66189354-66189376 CCAGCTTGGCTGTCTTCTGGGGG No data
1139330921_1139330926 -10 Left 1139330921 16:66189339-66189361 CCGAGATCAAACCCACCAGCTTG No data
Right 1139330926 16:66189352-66189374 CACCAGCTTGGCTGTCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139330921 Original CRISPR CAAGCTGGTGGGTTTGATCT CGG (reversed) Intergenic
No off target data available for this crispr