ID: 1139331589

View in Genome Browser
Species Human (GRCh38)
Location 16:66196545-66196567
Sequence TCCCTGAACCCAGTAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139331589_1139331591 -1 Left 1139331589 16:66196545-66196567 CCACCAGCTACTGGGTTCAGGGA No data
Right 1139331591 16:66196567-66196589 AAAGAACCTGCAGCTGTGCGAGG No data
1139331589_1139331596 30 Left 1139331589 16:66196545-66196567 CCACCAGCTACTGGGTTCAGGGA No data
Right 1139331596 16:66196598-66196620 TCCCATTAGGGCCTTCATACAGG No data
1139331589_1139331594 18 Left 1139331589 16:66196545-66196567 CCACCAGCTACTGGGTTCAGGGA No data
Right 1139331594 16:66196586-66196608 GAGGTGACCATATCCCATTAGGG No data
1139331589_1139331593 17 Left 1139331589 16:66196545-66196567 CCACCAGCTACTGGGTTCAGGGA No data
Right 1139331593 16:66196585-66196607 CGAGGTGACCATATCCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139331589 Original CRISPR TCCCTGAACCCAGTAGCTGG TGG (reversed) Intergenic
No off target data available for this crispr