ID: 1139331592

View in Genome Browser
Species Human (GRCh38)
Location 16:66196573-66196595
Sequence TGGTCACCTCGCACAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139331592_1139331594 -10 Left 1139331592 16:66196573-66196595 CCTGCAGCTGTGCGAGGTGACCA No data
Right 1139331594 16:66196586-66196608 GAGGTGACCATATCCCATTAGGG No data
1139331592_1139331596 2 Left 1139331592 16:66196573-66196595 CCTGCAGCTGTGCGAGGTGACCA No data
Right 1139331596 16:66196598-66196620 TCCCATTAGGGCCTTCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139331592 Original CRISPR TGGTCACCTCGCACAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr