ID: 1139331596

View in Genome Browser
Species Human (GRCh38)
Location 16:66196598-66196620
Sequence TCCCATTAGGGCCTTCATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139331592_1139331596 2 Left 1139331592 16:66196573-66196595 CCTGCAGCTGTGCGAGGTGACCA No data
Right 1139331596 16:66196598-66196620 TCCCATTAGGGCCTTCATACAGG No data
1139331590_1139331596 27 Left 1139331590 16:66196548-66196570 CCAGCTACTGGGTTCAGGGAAAG No data
Right 1139331596 16:66196598-66196620 TCCCATTAGGGCCTTCATACAGG No data
1139331589_1139331596 30 Left 1139331589 16:66196545-66196567 CCACCAGCTACTGGGTTCAGGGA No data
Right 1139331596 16:66196598-66196620 TCCCATTAGGGCCTTCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139331596 Original CRISPR TCCCATTAGGGCCTTCATAC AGG Intergenic
No off target data available for this crispr