ID: 1139334378

View in Genome Browser
Species Human (GRCh38)
Location 16:66220922-66220944
Sequence GCTTGCTCAGCTGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139334378_1139334382 -7 Left 1139334378 16:66220922-66220944 CCCTGAGCACCAGCTGAGCAAGC No data
Right 1139334382 16:66220938-66220960 AGCAAGCCCCAGAAGACCCTGGG No data
1139334378_1139334384 -2 Left 1139334378 16:66220922-66220944 CCCTGAGCACCAGCTGAGCAAGC No data
Right 1139334384 16:66220943-66220965 GCCCCAGAAGACCCTGGGAAGGG No data
1139334378_1139334383 -3 Left 1139334378 16:66220922-66220944 CCCTGAGCACCAGCTGAGCAAGC No data
Right 1139334383 16:66220942-66220964 AGCCCCAGAAGACCCTGGGAAGG No data
1139334378_1139334381 -8 Left 1139334378 16:66220922-66220944 CCCTGAGCACCAGCTGAGCAAGC No data
Right 1139334381 16:66220937-66220959 GAGCAAGCCCCAGAAGACCCTGG No data
1139334378_1139334388 8 Left 1139334378 16:66220922-66220944 CCCTGAGCACCAGCTGAGCAAGC No data
Right 1139334388 16:66220953-66220975 ACCCTGGGAAGGGAAGTCACAGG No data
1139334378_1139334391 21 Left 1139334378 16:66220922-66220944 CCCTGAGCACCAGCTGAGCAAGC No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139334378 Original CRISPR GCTTGCTCAGCTGGTGCTCA GGG (reversed) Intergenic