ID: 1139334384

View in Genome Browser
Species Human (GRCh38)
Location 16:66220943-66220965
Sequence GCCCCAGAAGACCCTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139334375_1139334384 29 Left 1139334375 16:66220891-66220913 CCTCACTCAACTCTGCAGCACTT No data
Right 1139334384 16:66220943-66220965 GCCCCAGAAGACCCTGGGAAGGG No data
1139334376_1139334384 6 Left 1139334376 16:66220914-66220936 CCTGCCTGCCCTGAGCACCAGCT No data
Right 1139334384 16:66220943-66220965 GCCCCAGAAGACCCTGGGAAGGG No data
1139334378_1139334384 -2 Left 1139334378 16:66220922-66220944 CCCTGAGCACCAGCTGAGCAAGC No data
Right 1139334384 16:66220943-66220965 GCCCCAGAAGACCCTGGGAAGGG No data
1139334377_1139334384 2 Left 1139334377 16:66220918-66220940 CCTGCCCTGAGCACCAGCTGAGC No data
Right 1139334384 16:66220943-66220965 GCCCCAGAAGACCCTGGGAAGGG No data
1139334379_1139334384 -3 Left 1139334379 16:66220923-66220945 CCTGAGCACCAGCTGAGCAAGCC No data
Right 1139334384 16:66220943-66220965 GCCCCAGAAGACCCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139334384 Original CRISPR GCCCCAGAAGACCCTGGGAA GGG Intergenic