ID: 1139334391

View in Genome Browser
Species Human (GRCh38)
Location 16:66220966-66220988
Sequence AAGTCACAGGTGCTTGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139334377_1139334391 25 Left 1139334377 16:66220918-66220940 CCTGCCCTGAGCACCAGCTGAGC No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data
1139334387_1139334391 -3 Left 1139334387 16:66220946-66220968 CCAGAAGACCCTGGGAAGGGAAG No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data
1139334380_1139334391 12 Left 1139334380 16:66220931-66220953 CCAGCTGAGCAAGCCCCAGAAGA No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data
1139334385_1139334391 -1 Left 1139334385 16:66220944-66220966 CCCCAGAAGACCCTGGGAAGGGA No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data
1139334378_1139334391 21 Left 1139334378 16:66220922-66220944 CCCTGAGCACCAGCTGAGCAAGC No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data
1139334386_1139334391 -2 Left 1139334386 16:66220945-66220967 CCCAGAAGACCCTGGGAAGGGAA No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data
1139334376_1139334391 29 Left 1139334376 16:66220914-66220936 CCTGCCTGCCCTGAGCACCAGCT No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data
1139334379_1139334391 20 Left 1139334379 16:66220923-66220945 CCTGAGCACCAGCTGAGCAAGCC No data
Right 1139334391 16:66220966-66220988 AAGTCACAGGTGCTTGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139334391 Original CRISPR AAGTCACAGGTGCTTGCCGC TGG Intergenic