ID: 1139338318

View in Genome Browser
Species Human (GRCh38)
Location 16:66249376-66249398
Sequence TAGAGAATTTAGAGACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139338318_1139338320 -5 Left 1139338318 16:66249376-66249398 CCTTCCTGTCTCTAAATTCTCTA No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139338318 Original CRISPR TAGAGAATTTAGAGACAGGA AGG (reversed) Intergenic
No off target data available for this crispr