ID: 1139338319

View in Genome Browser
Species Human (GRCh38)
Location 16:66249380-66249402
Sequence GAGGTAGAGAATTTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139338319_1139338320 -9 Left 1139338319 16:66249380-66249402 CCTGTCTCTAAATTCTCTACCTC No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139338319 Original CRISPR GAGGTAGAGAATTTAGAGAC AGG (reversed) Intergenic
No off target data available for this crispr