ID: 1139338320

View in Genome Browser
Species Human (GRCh38)
Location 16:66249394-66249416
Sequence CTCTACCTCTCCCACAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139338318_1139338320 -5 Left 1139338318 16:66249376-66249398 CCTTCCTGTCTCTAAATTCTCTA No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data
1139338314_1139338320 4 Left 1139338314 16:66249367-66249389 CCTCCCCAACCTTCCTGTCTCTA No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data
1139338316_1139338320 0 Left 1139338316 16:66249371-66249393 CCCAACCTTCCTGTCTCTAAATT No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data
1139338315_1139338320 1 Left 1139338315 16:66249370-66249392 CCCCAACCTTCCTGTCTCTAAAT No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data
1139338319_1139338320 -9 Left 1139338319 16:66249380-66249402 CCTGTCTCTAAATTCTCTACCTC No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data
1139338313_1139338320 28 Left 1139338313 16:66249343-66249365 CCACGAAGGACAGCAATTGTTTT No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data
1139338317_1139338320 -1 Left 1139338317 16:66249372-66249394 CCAACCTTCCTGTCTCTAAATTC No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data
1139338312_1139338320 29 Left 1139338312 16:66249342-66249364 CCCACGAAGGACAGCAATTGTTT No data
Right 1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139338320 Original CRISPR CTCTACCTCTCCCACAGCAC AGG Intergenic
No off target data available for this crispr