ID: 1139340053

View in Genome Browser
Species Human (GRCh38)
Location 16:66262601-66262623
Sequence AGGCTGTGCCCTCATCCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139340053_1139340056 3 Left 1139340053 16:66262601-66262623 CCTAGGGGATGAGGGCACAGCCT No data
Right 1139340056 16:66262627-66262649 AGCACCTGCCTCAGCTGTTATGG No data
1139340053_1139340059 30 Left 1139340053 16:66262601-66262623 CCTAGGGGATGAGGGCACAGCCT No data
Right 1139340059 16:66262654-66262676 TGTTTTCACCACAAAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139340053 Original CRISPR AGGCTGTGCCCTCATCCCCT AGG (reversed) Intergenic