ID: 1139340056

View in Genome Browser
Species Human (GRCh38)
Location 16:66262627-66262649
Sequence AGCACCTGCCTCAGCTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139340053_1139340056 3 Left 1139340053 16:66262601-66262623 CCTAGGGGATGAGGGCACAGCCT No data
Right 1139340056 16:66262627-66262649 AGCACCTGCCTCAGCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139340056 Original CRISPR AGCACCTGCCTCAGCTGTTA TGG Intergenic
No off target data available for this crispr