ID: 1139340059

View in Genome Browser
Species Human (GRCh38)
Location 16:66262654-66262676
Sequence TGTTTTCACCACAAAATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139340054_1139340059 10 Left 1139340054 16:66262621-66262643 CCTCCTAGCACCTGCCTCAGCTG No data
Right 1139340059 16:66262654-66262676 TGTTTTCACCACAAAATCCCTGG No data
1139340058_1139340059 -4 Left 1139340058 16:66262635-66262657 CCTCAGCTGTTATGGTTGCTGTT No data
Right 1139340059 16:66262654-66262676 TGTTTTCACCACAAAATCCCTGG No data
1139340053_1139340059 30 Left 1139340053 16:66262601-66262623 CCTAGGGGATGAGGGCACAGCCT No data
Right 1139340059 16:66262654-66262676 TGTTTTCACCACAAAATCCCTGG No data
1139340057_1139340059 0 Left 1139340057 16:66262631-66262653 CCTGCCTCAGCTGTTATGGTTGC No data
Right 1139340059 16:66262654-66262676 TGTTTTCACCACAAAATCCCTGG No data
1139340055_1139340059 7 Left 1139340055 16:66262624-66262646 CCTAGCACCTGCCTCAGCTGTTA No data
Right 1139340059 16:66262654-66262676 TGTTTTCACCACAAAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139340059 Original CRISPR TGTTTTCACCACAAAATCCC TGG Intergenic
No off target data available for this crispr