ID: 1139340451

View in Genome Browser
Species Human (GRCh38)
Location 16:66264772-66264794
Sequence TCCCGCTGGCTGTCCTGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139340451_1139340456 6 Left 1139340451 16:66264772-66264794 CCCGGGCAGGACAGCCAGCGGGA No data
Right 1139340456 16:66264801-66264823 GTTAAATCCGCCCTCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139340451 Original CRISPR TCCCGCTGGCTGTCCTGCCC GGG (reversed) Intergenic